missing translation for 'onlineSavingsMsg'
Learn More

Invitrogen™ T7 Promoter Primer

Primers for PCR amplification that complement many vectors

Brand:  Invitrogen™ N56002

Code : 50

Additional Details : Weight : 0.01000kg

Product Code. 11675591

  • £229.00 / 2µg

Estimated Shipment
23-06-2021

Please to purchase this item. Need a web account? Register with us today!


For Research Use Only. All usage must comply with product instructions.
 

Description

Description

  • Desalted and purified by gel filtration
  • Assayed for function by PCR amplification
  • Provided in 2μg quantity
  • T7: 5'- TAATACGACTCACTATAGGG- 3'

Sanger Sequencing, Sanger Sequencing Technology & Accessories, Sequencing

Order Info

Shipping Conditions: Room Temperature

Specifications

Specifications

T7
20 m
2 µg
5´d[TAATACGACTCACTATAGGG]3´
Room Temperature
Desalted, Gel Filtration Purified
327 picomole
Primer
Lyophilized
20 -mer
Gel-Purified
PCR Amplification
T7 Primers
Videos
SDS
Documents

For Research Use Only. Not for use in diagnostic procedures.