Thermo Scientific™ Oligo(dT)₁₈ Primer is a synthetic single-stranded 18-mer oligonucleotide with 5'- and 3'-hydroxyl ends. 120 UL OLIGO(DT)18 PRIMER, 100µM 120µL STORE AT-20°C

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. SP6 PRIM 18-MER 10UM 5.6 NMOL

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. T3 PRIMER 17-MER 10UM 6NMOL

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. T3 PRIMER 24-MER 10UM 4.2NMOL

Accurately sequence DNA with M13 pUC sequencing primers, single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. 6 NMOL M13/PUC SEQUENCING PRIMER (-20), 17-MER,5'-d(GTAAAACGACGGCCAGT)-3', 10µm, 6nmol Store at

Sequence DNA fragments inserted into the MCS of various pUC19 based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. M13/PUC REV -46 10UM 4.2NMOL

Sequence DNA fragments inserted into the MCS of various pUC19 based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. 6 NMOL M13/PUC SEQUENCING PRIMER (-40), 17-MER,5'-d(GTTTTCCCAGTCACGAC)-3', 10µm, 6nmol Store at

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. T7 PRIMER 20-MER 10UM 5NMOL

Sequence DNA fragments inserted into the MCS of various pUC19 based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. M13/PUC PRIM -46 10UM 4.5NMOL

Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2 and for colony screening by PCR. PJET1.2 FORWARD SEQUENCING PRIMER, 23-MER, 5'-D(CGACTCACTATAGGGAGAGCGGC)-3, 10µm, 8.7nmol Store at

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. SP6 PRIM 24-MER 10UM 4.2NMOL

Sequence DNA fragments inserted into the MCS of various pUC19-based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. 6 NMOL M13/PUC REVERSE SEQUENCING PRIMER (-26),17-mer 5'-d(CAGGAAACAGCTATGAC)-3', 10µm, 6nmol

Optimze cDNA synthesis with these random hexamer primers, oligo(dT)₁₈ primers and anchored oligo dT primers. 120 UL RANDOM HEXAMER PRIMER, 100µM 120µL STOREat -20°C

Perform highly efficient random priming of DNA synthesis reactions with this mixture of single-stranded random oligonucleotides. 100 UL EXO-RESISTANT RANDOM PRIMER, 5'-NPNPNPNPNPSNpSN-3', 500µm 100µL Store at -20°C

Template primers POLY (A) 100 MG

Template primers POLY (A) 500 MG