missing translation for 'onlineSavingsMsg'
Learn More

Thermo Scientific™ pJET1.2 Reverse Sequencing Primer, 24-mer

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends.

Brand:  Thermo Scientific™ SO511

61.65 GBP valid until 2025-06-30
Use promo code "24074" to get your promotional price.


Product Code. 10659920

  • £77.75 / Each

Please to purchase this item. Need a web account? Register with us today!

Explore more special offers
This item is not returnable. View return policy

Description

Description

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2 sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.

Applications
• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2p sequence
• Colony screening by PCR

pJET1.2 Primer sequences
• pJET1.2 forward sequencing primer, 23-mer: 5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
• pJET1.2 reverse sequencing primer, 24-mer: 5'-d(AAGAACATCGATTTTCCATGGCAG)-3'

Related products
pJET1.2 Forward Sequencing Primer, 23-mer (Cat. No.SO501)

TRUSTED_SUSTAINABILITY
Specifications

Specifications

Forward Sequencing Primer
Dry Ice
pJET
pJET1.2
Liquid
pJET1.2 Forward Sequencing Primer, 23-mer, 10 μM (84 μL)

Store at –20°C.
10 μM
10 μM, 84 μL
Sequencing
Product Suggestions

Product Suggestions

Videos
SDS
Documents

Documents

One moment while we fetch your results.
Certificates
Special Offers

Special Offers

Product Content Correction

Your input is important to us. Please complete this form to provide feedback related to the content on this product.

Product Title
Thermo Scientific™ pJET1.2 Reverse Sequencing Primer, 24-mer > 10 uM, 8.4 nmol

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.

Thank You! Your feedback has been submitted. Fisher Scientific is always working to improve our content for you. We appreciate your feedback.

For Research Use Only. Not for use in diagnostic procedures.