missing translation for 'onlineSavingsMsg'
Learn More

Thermo Scientific™ M13/pUC Sequencing Primer (-46), 22-mer

Thermo Scientific M13/pUC Sequencing Primer (-46), 22-mer is a synthetic single-stranded 22-mer oligonucleotide with free 5'- and 3'-hydroxyl ends.

Brand:  Thermo Scientific™ SO114

36.65 GBP valid until 2025-06-30
Use promo code "24074" to get your promotional price.


Product Code. 10384680

  • £45.49 / Each

Please to purchase this item. Need a web account? Register with us today!

Explore more special offers
This item is not returnable. View return policy

Description

Description

Thermo Scientific M13/pUC Sequencing Primer (-46), 22-mer is a synthetic single-stranded 22-mer oligonucleotide with free 5'- and 3'-hydroxyl ends. This M13/pUC primer anneals to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 μM aqueous solutions.

Applications
• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19 (Cat. No. SM0221), pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR

Primer Sequence: 5'-d(GCCAGGGTTTTCCCAGTCACGA)-3'

TRUSTED_SUSTAINABILITY
Specifications

Specifications

Sequencing Primer
Dry Ice
M13
pUC19, pTZ19R, pTZ57R, M13mp18, pBluescript II
Liquid
M13/pUC Sequencing Primer (-46), 22-mer, 10 μM (45 μL)

Store at –20°C.
10 μM
10 μM, 45 μL
Sequencing
Product Suggestions

Product Suggestions

Videos
SDS
Documents

Documents

One moment while we fetch your results.
Certificates
Special Offers

Special Offers

Product Content Correction

Your input is important to us. Please complete this form to provide feedback related to the content on this product.

Product Title
Thermo Scientific™ M13/pUC Sequencing Primer (-46), 22-mer > 10 uM, 4.5 nmol

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.

Thank You! Your feedback has been submitted. Fisher Scientific is always working to improve our content for you. We appreciate your feedback.

For Research Use Only. Not for use in diagnostic procedures.