Serve as primers for DNA synthesis by a DNA polymerase or reverse transcriptase 1 SET Random Hexamers (50um) 1kit Store at -20 C

Truly random primers suitable for DNA synthesis using Klenow fragments with DNA templates or for cDNA synthesis using reverse transcriptase with mRNA templates RANDOM PRIMERS,1.5MM 9 units

Used for first-strand cDNA synthesis with reverse transcriptase at temperatures of ≥50°C OLIGO DT(20) PRIMER

Optimze cDNA synthesis with these random hexamer primers, oligo(dT)₁₈ primers and anchored oligo dT primers. 120 UL RANDOM HEXAMER PRIMER, 100µM 120µL STOREat -20°C

Thermo Scientific™ Oligo(dT)₁₈ Primer is a synthetic single-stranded 18-mer oligonucleotide with 5'- and 3'-hydroxyl ends. 60 UL OLIGO(DT)18 PRIMER, 100µM 60µL STORE AT-20°C

Primer is suitable for use in first-strand cDNA synthesis with reverse transcriptase Oligo(dT)12 18 Primer, 25 µg

Template primers POLY (A) 500 MG

Provided at a stock concentration of 50μM 80 UL OLIGO (DT) PRIMER (50 UM) 80µL STORE AT-20°C

Oligonucleotides complementary to a DNA template are necessary to prime DNA synthesis for sequencing reactions 2UG PRIM,M13(-20)FORWARD

Primers for PCR amplification that complement many vectors PRIMER, T7Invitrogen offers primers for PCR amplification

Perform highly efficient random priming of DNA synthesis reactions with this mixture of single-stranded random oligonucleotides. 100 UL EXO-RESISTANT RANDOM PRIMER, 5'-NPNPNPNPNPSNpSN-3', 500µm 100µL Store at -20°C

Provided at a stock concentration of 50μM, and functionally tested using the RETROscript™ Kit 80 UL RANDOM DECAMERS (50 UM) 80µL STORE AT -20 C

Sequence DNA fragments inserted into the MCS of various pUC19-based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. 6 NMOL M13/PUC REVERSE SEQUENCING PRIMER (-26),17-mer 5'-d(CAGGAAACAGCTATGAC)-3', 10µm, 6nmol

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. T7 PRIMER 20-MER 10UM 5NMOL

Accurately sequence DNA with M13 pUC sequencing primers, single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. 6 NMOL M13/PUC SEQUENCING PRIMER (-20), 17-MER,5'-d(GTAAAACGACGGCCAGT)-3', 10µm, 6nmol Store at

Contain mixtures of linearized plasmids ready for use as templates as part of in vitro transcription reactions for synthesis of labeled RNA molecular size standards 5 UG CENTURY MARKER TEMPLATES 5µG STORE AT -20 C

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. T3 PRIMER 17-MER 10UM 6NMOL

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. T3 PRIMER 24-MER 10UM 4.2NMOL

When incorporated into DNA, 5-(3-aminoallyl)-dUTP provides a reactive group for addition of other chemical groups 50MM 5-(3-AMINOALLYL)-UTP 5ULAmbion® Modified nucleotides confer unique

Ambion Modified nucleotides confer unique characteristics to the RNA molecules into which they are incorporated 50MM 5-(3-AMINOALLYL)-UTP 50ULAmbion® Modified nucleotides confer unique

Sequence DNA fragments inserted into the MCS of various pUC19 based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. M13/PUC REV -46 10UM 4.2NMOL

Sequence DNA fragments inserted into the MCS of various pUC19 based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. 6 NMOL M13/PUC SEQUENCING PRIMER (-40), 17-MER,5'-d(GTTTTCCCAGTCACGAC)-3', 10µm, 6nmol Store at

Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2 and for colony screening by PCR. PJET1.2 FORWARD SEQUENCING PRIMER, 23-MER, 5'-D(CGACTCACTATAGGGAGAGCGGC)-3, 10µm, 8.7nmol Store at

Ambion Lambda DNA is digested to completion with Hind III 0.5 MG LAMBDA DNA - HIND III DIGESTED 0.5MG STOREat -20°C

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. SP6 PRIM 18-MER 10UM 5.6 NMOL

Primer mixture consisting of a string of 20 deoxythymidylic acid residues followed by dV (either dG, dA, or dC) and then by dN (dA, dT, dG, or dC) ANCHORED OLIGO(DT) 20 PRIM50UG

Oligonucleotides complementary to a DNA template are necessary to prime DNA synthesis for sequencing reactions 2UG PRIM,M13 REVERSE

Ideal for use as substrates as part of in vitro transcription reactions 30 UL BIO-11-UTP 30µL STORE AT -80°C

Used for priming and reverse transcription of polyadenylated (poly A+) mRNA OLIGO D(T)16 PRIMERApplied Biosystems® Oligo d(T)16 is a

Ambion pUC 19 DNA is digested to completion with Sau3A I 0.5 MG PUC19 DNA - SAU3A I DIGESTED 0.5MG STOREat -20 C